Jump to content
ClubAdventist

Recommended Posts

  • Moderators
Posted

That evidence is not evidence that evolution predicts (outside the fossil record, which you seem to reject), and therefore the absence of that evidence is not something that can be used to falsify evolution.

The theory of gravity does not predict that people will be able to jump from earth into space using the power of their own legs. The fact that people cannot do so is not evidence that the theory of gravity is flawed - it is simply irrelevant to the theory of gravity.

The theory of evolution does not predict that change from one 'kind' (by which you seem to mean something more dramatic than the biological term 'species') will occur within timescales perceptible within short human life spans. The fact that such changes are in fact not observed is irrelevant to the theory of evolution, since it never predicted them in the first place.

Anyway, my longish post on world views in Stan's 'why origins discussions get silly' thread in the Origins forum might be useful for all of us in why we seem to be speaking so much at cross-purposes in this thread and this whole discussion.

Truth is important

  • Replies 547
  • Created
  • Last Reply

Top Posters In This Topic

  • BobRyan

    133

  • jasd

    63

  • Bravus

    58

Posted

That evidence is not evidence that evolution predicts (outside the fossil record, which you seem to reject), and therefore the absence of that evidence is not something that can be used to falsify evolution.

The theory of gravity does not predict that people will be able to jump from earth into space using the power of their own legs. The fact that people cannot do so is not evidence that the theory of gravity is flawed - it is simply irrelevant to the theory of gravity.

The theory of evolution does not predict that change from one 'kind' (by which you seem to mean something more dramatic than the biological term 'species') will occur within timescales perceptible within short human life spans. The fact that such changes are in fact not observed is irrelevant to the theory of evolution, since it never predicted them in the first place.

Anyway, my longish post on world views in Stan's 'why origins discussions get silly' thread in the Origins forum might be useful for all of us in why we seem to be speaking so much at cross-purposes in this thread and this whole discussion.

So to summarise the points above:

1. Change from one kind to another is so gradual and small it cannot be seen.

2. So any change or variation within an animal is considered evidence for that thing that cannot be seen.

This ignores one fundamental problem, change however small, where new information is added to existing information, has not been evidenced.

What is being pointed to is an alphabet of 27 letters being recombined to prove that an alphabet of 28 letters is possible.

The only thing you have shown is a variation with the letters already present.

Nobody is arguing with that.

The thing you have not shown and would in fact be evidence that one kind (fish) turned into another (reptile), is how additional "letters" are added to the alphabet.

So show us an example of an extra letter being added to the alphabet and you have "evidence", until then you do not have evidence for showing one kind can turn into another, which idea you are supporting.

You have above admitted above there is an absence of that evidence in "real time".

Then you point to the fossil record.

So please show us in the fossil record where this has happened.

From one kind to another with intermediary links.

Mark :-)

The best wisdom is always second hand...

  • Moderators
Posted

Um, there are 4 letters in the alphabet, and they are all that's needed to code everything from the tiniest virus that's barely alive to the blue whale (and us). I have brought multiple examples of new genetic material being added, but it has been rejected at every turn.

http://en.wikipedia.org/wiki/Transitional_fossil

http://evolution.berkeley.edu/evosite/lines/IAtransitional.shtml

http://www.talkorigins.org/faqs/faq-transitional.html

And so on.

Can I confidently predict that all will be rejected? On some spurious grounds or other?

Look, if all the evidence you need is a particular reading of the Bible, you've got it. So rest secure in that.

Truth is important

Posted

Um, there are 4 letters in the alphabet, and they are all that's needed to code everything from the tiniest virus that's barely alive to the blue whale (and us). I have brought multiple examples of new genetic material being added, but it has been rejected at every turn.

http://en.wikipedia.org/wiki/Transitional_fossil

http://evolution.berkeley.edu/evosite/lines/IAtransitional.shtml

http://www.talkorigins.org/faqs/faq-transitional.html

And so on.

Can I confidently predict that all will be rejected? On some spurious grounds or other?

Look, if all the evidence you need is a particular reading of the Bible, you've got it. So rest secure in that.

That is a twisting of the analogy.

A bit like saying all the letters are written in black ink, so it doesn't matter what they are made from.

Can you provide any evidence of an "increase" in information in DNA, not just a re-arrangement of DNA.

This is what you need to prove your point.

Mark

The best wisdom is always second hand...

  • Moderators
Posted

But what does that even *mean*? That is exactly my point! DNA is a series of the 4 bases in particular arrangements. Can *you* tell a genuinely novel section of GCCTAATACAGGCGCACTTACCAGGGACACTTAACT from another? You haven't defined your terms as to what counts as new DNA! Apparently antibiotic resistance in bacteria isn't, new flu strains isn't, new species of a wide variety of things isn't.

It's not that the evidence I'm bringing is flawed, it's that your asking questions that are not susceptible to evidence as they're asked.

Anyway, some modern, observed examples of speciation: http://www.talkorigins.org/faqs/faq-speciation.html

Truth is important

Posted

Now we've got that issue out of the way (I hope), and our jokes as well.

Twilight, do you think it's honest to go on repeating "I have not seen one shred of evidence" when several large chunks of evidence have been shown to you? You have rejected them, and will no doubt continue to reject any further chunks offered.

Would it be honest to say "I did all this work and the boss did not pay me one shred" when the boss had offered your pay half a dozen times and each time you had rejected it because it was a cheque not cash, or because the denominations of the notes did not suit you?

Are you willing to at least amend your statement to "I have not seen one shred of evidence that was convincing to me"? That's very similar, but makes clearer what's going on.

As to the pernicious affect of evolution on the foundation of Christianity, that is a no brainier. In truth the Empiricists mindset has attempted to usurp the place of religion! It was the Empiricist of the enlightenment that assailed the a priori concepts of Christian morality to supplant them with moral relativism which then heightened amorality. Idolatry concerns the affections of the mind in the long established a priori concepts of salvation, source of miracles, means to rise to the heavens and immortality. The Empiricists/Materialist have gratuitously trafficked their epistemology as PURE SCIENCE in order to gain these affections and supplant their philosophies.

As to the science of evolution, the problem with the evidence of evolutionists is that it is ALWAYS tainted with their epistemology. If Empiricism and its epistemology would confine itself to a better mousetrap, what is fasifyable and testable, then their work would truly be utilitarian. But when Empiricists gratuitously traffic their epistemology as PURE SCIENCE to feign answers as to who we are, where we came from, what we can know, the meaning of life and morals without redress to fasifyabilty and testability then they attempt to usurp the place of religion!

By the epistemology of empiricalism I mean its world view that life is meaningless and purposeless and that’s its a priori view by which they view all their empirical evidence. This is definitely a worldview, metaphysics, because it has an a priori view that the universe has always worked this way and always will. Empiricism’s epistemics simply cannot account for contingency or variables, particularly in past phenomenon before man. This makes Empiricism merely another philosophical worldview, metaphysics, and that is why it immediately led to moral relativism.

Michael

Posted

Um, there are 4 letters in the alphabet, and they are all that's needed to code everything from the tiniest virus that's barely alive to the blue whale (and us). I have brought multiple examples of new genetic material being added, but it has been rejected at every turn.

http://en.wikipedia.org/wiki/Transitional_fossil

http://evolution.berkeley.edu/evosite/lines/IAtransitional.shtml

http://www.talkorigins.org/faqs/faq-transitional.html

And so on.

Can I confidently predict that all will be rejected? On some spurious grounds or other?

Look, if all the evidence you need is a particular reading of the Bible, you've got it. So rest secure in that.

I have also looked at the transitional fossil link you have provided...

Is there any particular creature in that that you would be happy to put forward as "proven" intermediary?

Mark

The best wisdom is always second hand...

  • Moderators
Posted

Nope. I have published work on the philosophy of science, and I know very well that science *never* claims *anything* as 'proven'. 'Supported by the best available evidence' is as far as we'll go, and I'm very happy to go that far with any of those examples.

Truth is important

Posted

Nope. I have published work on the philosophy of science, and I know very well that science *never* claims *anything* as 'proven'. 'Supported by the best available evidence' is as far as we'll go, and I'm very happy to go that far with any of those examples.
Posted

Read the drosophila article *again* - third time is the charm. New genes, coding for new proteins, leading to new species. Exactly what you asked for.

The paper I linked is actually an editorial, providing groundwork for this scientific paper in the journal: http://genome.cshlp.org/content/10/11/17...pe2=tf_ipsecsha

(being called away, back in a while to continue...)

Question:

If evolution is proven and based on scientific fact.

100% proven.

Then man should be able to reverse engineer that evolution.

Has man been able to "manufacture" evolution Bravus?

Because if it is scientifically proven, then you must have the mechanisms in place to produce that in the lab.

One kind into another?

Mark

The best wisdom is always second hand...

Posted

Originally Posted By: Bravus
Nope. I have published work on the philosophy of science, and I know very well that science *never* claims *anything* as 'proven'. 'Supported by the best available evidence' is as far as we'll go, and I'm very happy to go that far with any of those examples.

In the book “Readings in the Philosophy of Language” the authors deal with the language of science; to wit, is there a clear distinction between statements that are analytic or synthetic, between philosophic or scientific in nature? Again, falsifyabity of scientific statements enters the issue when Putnam wrote:

Quote:
“Principles as central to the conceptual system of science as laws of geometry are simply not abandoned in the face of experiment alone. They are abandoned because a rival theory is available.” (Readings in the Philosophy of Language, edited by Rosenberg and Travis, Hilary Putnam, “the Analytic and the Synthetic,” Prentice-Hall Inc., 1971, page. 106)

The theory of evolution is caught in the paradox that it can never be scientific, by its own definitions, until it is acknowledges the possibility of another rival theory that would falsify it. Where is another rival theory! Maybe little green men from another planet came and made life here. The truth is that there is only one other intellectually honest rival and that is God! The objective answer is that in the case of origins the epistemic ontology of Empiricism is woefully inadequate to even address the issue!

Michael

Amen Michael

Posted

Hey, Michael's here!

Welcome,

g

"Please don't feed the drama queens.."

Posted

You haven't defined your terms as to what counts as new DNA! Apparently antibiotic resistance in bacteria isn't, new flu strains isn't, new species of a wide variety of things isn't.

It's not that the evidence I'm bringing is flawed, it's that your asking questions that are not susceptible to evidence as they're asked.

Anyway, some modern, observed examples of speciation: http://www.talkorigins.org/faqs/faq-speciation.html

Interesting - the Bacteria argument was debunked a long time ago when you admitted that this is not a case of Bacteria DNA changing at all - just a case of Plasmid RNA that is not even part of the Bacteria's DNA -- yet you keep cirlcing back to this failed example as if a failed point is never to be rejected as proof of evolutionism.

I find that kind of odd.

Why keep doing that? What is the rationale?

in Christ,

Bob

John 8:32 - The Truth will make you free

“The righteousness of Christ will not cover one cherished sin." COL 316.

Posted

I have brought multiple examples of new genetic material being added, but it has been rejected at every turn.

http://en.wikipedia.org/wiki/Transitional_fossil

http://evolution.berkeley.edu/evosite/lines/IAtransitional.shtml

http://www.talkorigins.org/faqs/faq-transitional.html

And so on.

John 8:32 - The Truth will make you free

“The righteousness of Christ will not cover one cherished sin." COL 316.

Posted

Now getting back to the actual subject of the thread -- which is "how evolutionism destroys the SDA 28 Fundamental beliefs".

The point in the OP post and then proven in exhaustive detail in my response to Bravus -- is that evolutionism is flatly contradictory to some key beliefs in the set of 28 and we showed in our dialoge just how those beliefs are changed, contradicted or at the very least watered down.

The recent diversion to "evidence for evolutionism" is a valid topic and probably should be posted as it's own subject here - however it changes nothing in terms of this subject thread.

Let us say for the sake of argument that tomorrow a lab said -- hey look we found dirt that turns into an amoeba AND that can then turn into a human in about 50,000 generations all taking place in about a month. (Surely an extreme example but the idea is to take "as given" THE MOST EXTREME success story imaginable in favor of evolutionism.)

Truly it would be hard for anyone to argue that the evolutionist had not proven his case for the "fact of evolution" no longer being a by-faith-alone belief system - but a true observable repeatable science easily verified. They would finally have proven their flat-earth idea was valid.

The OP does not change one iota in that case - because the destruction that such a proven argument would do to the 28 FB is STILL as STATED.

Thus proving the point on this thread - that trying to imagine ways in which evolutionism might be anything other than a by-faith-alone argument does not actually change the proposal in the Opening Post (OP).

John 8:32 - The Truth will make you free

“The righteousness of Christ will not cover one cherished sin." COL 316.

  • Moderators
Posted

Bye

Truth is important

  • Moderators
Posted

(I provide links rather than copy-and-paste to conserve board space and to allow people to read things in their full context)

Truth is important

Posted

(I provide links rather than copy-and-paste to conserve board space and to allow people to read things in their full context)

If you are not interested enough to state your case from the links you reference -- that is fine with me.

My custom continues to be that I show the reader the statement that makes my case and also point the reader to the link where that statement may be found so that they can check the whole thing out in context.

The contrast between our methods may also be instructive to the unbiased objective reader.

in Christ,

Bob

John 8:32 - The Truth will make you free

“The righteousness of Christ will not cover one cherished sin." COL 316.

  • Moderators
Posted

The truth is, there is no evidence that could ever convince you ('you' plural). It's as simple as that. I hereby cease trying.

Truth is important

Posted

you are free to structure your argument in whatever manner you choose.

I prefer the direct up front approach when I make my arguments.

In a recent post I point out that it is a clear nonsequitter to turn this topic into "ways to imagine that evolutionism is real science" or is even "possible" since the OP is not about "whether you think evolutionism can be shown to even be possible much less true".

Rather the thread is about the contrast between the 28 FB as stated today -- what would have to be done to them if one wanted to insert the doctrines of evolutionism into the church.

Thanks to your prior efforts we have a good case for just how those changes would have to proceed.

in Christ,

Bob

John 8:32 - The Truth will make you free

“The righteousness of Christ will not cover one cherished sin." COL 316.

Posted

The truth is, there is no evidence that could ever convince you ('you' plural). It's as simple as that. I hereby cease trying.
Posted

science does not oppose the 7 day creation account of the Bible - but belief in Evolutionism does. Two opposing religious doctrines for origins.

Even the devoutely atheist evolutionist Colin Patterson admitted to the disinctively religious nature of the argument for evolutionism.

in Christ,

Bob

John 8:32 - The Truth will make you free

“The righteousness of Christ will not cover one cherished sin." COL 316.

Posted

The truth is, there is no evidence that could ever convince you ('you' plural). It's as simple as that. I hereby cease trying.

Or is it the quality of evidence presented is lacking, so that it cannot be accepted as "proof"?

Either the evidence is faulty or those that believe the literal account of Genesis is accurate and inspired, is faulty.

This makes an interesting argument.

The best wisdom is always second hand...

Posted

Originally Posted By: Bravus
The truth is, there is no evidence that could ever convince you ('you' plural). It's as simple as that. I hereby cease trying.

Bravus,

The problem with being convinced of the biased slant of your (plural), or the Empiricist’s evidence, Bravus, is that undermines our faith to supplant it with yours! That was the gist of my prior posts. Your world view is NOT strict SCIENCE by any means, as you (plural) misrepresent it. It is hardly science to commence with a worldview in which everything started from randomness, chaos, meaninglessness and purposelessness and then feign that one can interpret evidence without bias. This is mere metaphysics. Of course there is going to be bias and the truly uncontroversial fact that Christianity and Evolution simply are at war with each other and those who think that they can uphold the two together are merely fooling themselves. One is faith in man and the other is faith is Yahweh. I choose the latter. And if you contest that it isn’t a war let me quote from one, William W. Cobern, Ph.D, an Associate Professor of Science Education at Arizona State University, who presented a paper entitled Worldview Theory and Conceptual Change in Science to a convention of science teachers at the 1994 annual meeting of the National Association for Research in Science Teaching, Anaheim, CA, March 26-29. He states his premise for writing the paper is:

Quote:
To borrow warfare metaphors, conceptual change activities are tactical devices used to reach small-scale objectives (i.e., individual science concepts) within a strategic framework for reaching the large-scale objective of scientific literacy.

(http://www.wmich.edu/slcsp/SLCSP124/SLCSP-124.pdf )

Cobern allows no quarter in his well documented assertion that science education has made war on the natural views of students that oppose the scientific worldview:

Quote:
In its extreme form, conceptual change is a tacit attempt to mimic a stereotypical scientific approach to experimentation: isolate, control, and manipulate. The science curriculum isolates the student from other domains of knowledge (especially what is called everyday knowledge) and attempts to control the classroom environment such that student attention is dominated by a teaching manipulation. No where is the idea of isolation made more clear than among researchers who call for students to break with everyday experience and thinking (e.g., Floden, Buchmann, and Schwille, 1987; Garrison and Bentley, 1990). Here it is argued that science conceptual change requires a breaking with what is essentially students' natural understanding of their world. Indeed, the common strategy of science education in which the conceptual change model is embedded creates a hermetic classroom environment conducive to breaking with other conceptual ideas. This strategy of isolation, control, and manipulation serves, in Eger's (1989, p. 85) words, the interest of science to have a functioning pipeline that delivers future scientists, but not interest in science which is the proper interest of most students. (Ibid)

Cobern certainly understands that the scientific worldview, metaphysics, is being implemented in the public schools by tactics that are unequivocally all out war.

Michael

And do you know the "ace up the sleeve" evolutionists often wheel out to win the "debate" with?

Theistic Evolutionists...

Nothing muddies the battle quite like that...

"Look, evolution is so proven the theists even accept it..."

Mark

The best wisdom is always second hand...

Join the conversation

You can post now and register later. If you have an account, sign in now to post with your account.

Guest
Reply to this topic...

×   Pasted as rich text.   Paste as plain text instead

  Only 75 emoji are allowed.

×   Your link has been automatically embedded.   Display as a link instead

×   Your previous content has been restored.   Clear editor

×   You cannot paste images directly. Upload or insert images from URL.


If you find some value to this community, please help out with a few dollars per month.



×
×
  • Create New...